Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10341A8
Clone ID IST10341A8
Vector VICTR76
Project tigm

Sequence tag IST10341A8BBF1
Sequence
TTGCTGGTATAAAAGCACGGGATGAACTAGTTTGAACCAGTGTGTCTGTGTATAACCAAGCTTATTTTCATCCTTAGGGT
TTTCAAACATAGCAATGTGCAAGGGTGCATGTGTGTGATAGGGACGGGTACACTTTTGGATGCATTGGAAGTGAAGGAAC
ACTTGTTCCTCTTTGGGGAAGGTCATANCANAGGAGGAGGAGGAAATTGAAAACACANTGGGCANAACTCCGAACAACAG
TAAGATCAAAATGAAGCCCTTCACCTCAAGGACCGCCTTAGTCTTGCACTCCATGCTGACCTAATGACTGCTCGGTTCCT
ACATAGTGCAGAGGTGAATACTCTGCCATTGGANACTCATCCTCANTCCTGTGTTCAATTCTTAAAGCGGAGCGCANNGG
GAGTCTTGGAGTGGGGGTAGTCGGGGCTTCAGCGGTCTGGCTAANGGTTGCTCAGTNNGTAGGGGGTAGAGAGCCCTGGG
ATGCCGCATAGCCCTCCN
Sequence Type genomic DNA
Unitrap ID UNI580

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101972033..101972528 474
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027860 (Vangl1) NM_177545 vang-like 1 (van gogh, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2159344]

 
Come back to gene ENSMUSG00000027860


For any suggestions or comments, please send an email to unitrap@crg.es