Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14452G8
Clone ID IST14452G8
Vector VICTR74
Project tigm

Sequence tag IST14452G8HMR1
Sequence
ATTGCCCTGAGTAAAATTCTCTGACACAACATCGTATGGGCTAACATGGGAGCTTAATTGAGGGTAAAATATATCTCATG
GTGCAATTTCCTCAACAGAATGTTGAAGAATGTTTGTTCCAAGATCTTTGAAAATCAAGAGGAGTTCTAATGATGACCTC
AAAAGCGGTGAAGCTAAAAAAAGCAAGCCAGAAGCAGGAGGCCTTCAGGTGGAGGGAGACAGAGATACTCCGGTCCACAC
ATCAGTCACTGAGGAAGCTGTCACAGCAGACAAGCCCGGCCATGCATCAAGCACCAACNGTCCTTCTTGCCAGTTGGCTG
AGGTTTCTTCCNCAGGACCTGATGANGGTGTGAANGACANCCACCCATCTGANNANCCTGTAAAGTCGTTTTCTAAAACC
NNNCGNTGN
Sequence Type genomic DNA
Unitrap ID UNI18641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138313061..138313460 384
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026404 (Ddx59) NM_026500 DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 Gene [Source:MGI (curated);Acc:Ddx59-001]


Sequence tag IST14452G8HMF1
Sequence
TAGTGAAGCCGTCATGTCCCTACTTAAGCCAACTTCCACTTATCAATTTCCTCTGGGGGAAGGGATACAGTCTTTTTCCT
CAGACACTGCCCTATGAAACACTGCCTACGGTTCCCCACAACCTTGCTGTGCACGCCACCTGTTTCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138312912..138313061 150
NO GENE  

 
Come back to gene ENSMUSG00000026404


For any suggestions or comments, please send an email to unitrap@crg.es