Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11644G4
Clone ID IST11644G4
Vector VICTR76
Project tigm

Sequence tag IST11644G4HMR1
Sequence
CTGAGGATCTGAGACCNAACCATCCCTTTTATAAGCAAGCCGGGACCACCCAACAGCTGTTTTTACCCCTGCTATTGCTA
TTCACTTGTCTTGTGATTGCTTGCCTGTGGACTGTCCTAGTACTTTCTTCCATTACCTGTTTTCCTCCTGCTCTAATGTT
CATGTACTCACGTAATAACTCTCTTAAGTACCTTCAGTGCCAAGGTCTCCTGAGATAGCTAGCAATCCAAGCTAGATAGT
GTANCCCCTGGTCTCGTGAGTTTTTTACTTATAAGTCAN
Sequence Type genomic DNA
Unitrap ID UNI29762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87724905..87725182 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019710 (Mrpl24) NM_026591 mitochondrial ribosomal protein L24 Gene [Source:MGI (curated);Acc:Mrpl24-002]

 
Come back to gene ENSMUSG00000019710


For any suggestions or comments, please send an email to unitrap@crg.es