Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10464G7
Clone ID IST10464G7
Vector VICTR76
Project tigm

Sequence tag IST10464G7HMR1
Sequence
CTACGTCACCACGTCTCTCAGTGGGATCTGGGCCTCGTTGGTTAGGCTGAGGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI8696

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9141014..9141069 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033499 (Larp5) NM_172585 La ribonucleoprotein domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:106330]

 
Come back to gene ENSMUSG00000033499


For any suggestions or comments, please send an email to unitrap@crg.es