Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST442178
Clone ID OST442178
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST442178
Sequence
ATTTGAGGTGACGTCTTTNAACCCTTTCCCAAGGGCTNTTTCCCAGATGAGCCTTTGCCGCAAGGCCCTCTTGACACCAN
GGATGACGACGCAAAACCTGCGGCAGCCAACACCCCTCTCCCCACTCTCCGCACTCACTGGTGGGTGCCACCATCCAGGA
AGCAAGTATCCCGAATTGACAGCTTGGTGCANAGGGGACATGAGAGGTGTCTCTGTCCAGCTAGGAAGCAGCTGGAAAAT
CTGCANGTTCACAGAGGTCCTCAAGACCAACGGACTCCTGGTGTGAACCCAATAAAGACTGTTTGCCT
Sequence Type mRNA
Unitrap ID UNI17468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 158201904..158202792 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044349 (A930034L06Rik) NM_175692 small nucleolar RNA host gene 11 (non-protein coding) Gene [Source:MGI Symbol;Acc:MGI:2441845]

 
Come back to gene ENSMUSG00000044349


For any suggestions or comments, please send an email to unitrap@crg.es