Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12267F3
Clone ID IST12267F3
Vector VICTR76
Project tigm

Sequence tag IST12267F3HMF2
Sequence
TACTGGCGTGCTGTGTTTTTATACTGGCTGAAGACATCATGGATGGCTTGTGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 109395989..109396042 54
 
EST/CDNA Est Name
  CD808149.1 - BI083362.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128995031..128995084 54
NO GENE  


Sequence tag IST12267F3BBF1
Sequence
TAAGTACACTGTAGCTGTCTTCCGACACTCCAGAAGAGAGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI29342 UNI30995 UNI30996 UNI31575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 193225758..193225807 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 82379729..82379778 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053302 (AC124384.4) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3UWJ8]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 14619194..14619243 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65725982..65726031 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 23000037..23000086 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040420 (Cdh18) cadherin 18 Gene [Source:MGI Symbol;Acc:MGI:1344366]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16028767..16028816 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 38138930..38138979 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 87659622..87659671 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87761479..87761528 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143651984..143652033 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25705605..25705654 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040940 (Arhgef1) NP_001123622 Rho guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Arhgef1-002]

 
Come back to gene ENSMUSG00000040940


For any suggestions or comments, please send an email to unitrap@crg.es