Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13992E11
Clone ID IST13992E11
Vector VICTR74
Project tigm

Sequence tag IST13992E11HMF2
Sequence
TTTNNNNTANTTCTGANNCNGCCTANGCTCCCGCTTTTNTTTCANTTCCAAGATGCCTTCNANNNNCNTTCCTCTGTTAA
GGGACATCTGGACTCTTTCNAGCTTCTGGCTATTATAAGTAAGGCTACTATAAACATAGTAGAGCATGTGTTCTTATTAC
ATGTTGGAGCATATTCTGGGTGTATGCCCAGGAGTGGTATTGCTGGATCCTCTGGTAGTACTATGTCCAATTTTCTGAAG
AACCGCCNGACTGACTTCCNNAGTGGTTGTACCAGCTTGCAATCCCACCAGCAATGAAAGTGTGTTCCTCTTTCTCCATA
TCCTCACCAGCATCTACTCTCATCTGANTTTTTGANCTTTGCCANTCTGANTGGTATGNNNTANAATCTCANGTTTATAT
TGATTTGCANTTCCCTAANGACTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13992E11BBF1
Sequence
ATGGTGGCTCACAACCATCCGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI12672 UNI30731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20308862..20308895 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26417983..26418016 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18030986..18031019 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 55580684..55580717 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34849562..34849595 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6042440..6042473 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068270 (Shroom4) NM_001040459 shroom family member 4 Gene [Source:MGI (curated);Acc:Shroom4-001]

 
Come back to gene ENSMUSG00000068270


For any suggestions or comments, please send an email to unitrap@crg.es