Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13247G8
Clone ID IST13247G8
Vector VICTR74
Project tigm

Sequence tag IST13247G8HMF1
Sequence
NTCTGGCTCGTTCTANATCCTGGATTTGATTCCTACCACCACACTGTAAATAACAAAACCAAAGTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 142520027..142520096 68
NO GENE  


Sequence tag IST13247G8HMR1
Sequence
NGTCTANGCTTANAATGTACTTTAAATTACTTTTGCGAAAGTTGTAAAGTCTACCCAATATTTGGTCTATATCTGCGTGT
TTGTTTTACTANTTTGTTAANTCNCTTACTGTNTTTTGGGTTNGCNTCNNACNGTTTAAATTGTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13247G8BBF1
Sequence
NTCTTTCTGCTTAAAAGGAGGATTGATTGCTACACAGGGAAAAGGCTCTCCAGCTAGGCTAAGAACGAGACCAGGAGTTC
CAGCCTCCTCCCAAAACGGGCCAGGGGTGGTTTGTGAATTTGATACCCAGAAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI29874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22430006..22430142 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es