Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15094E1
Clone ID IST15094E1
Vector VICTR80
Project tigm

Sequence tag IST15094E1HMF1
Sequence
AACTCAGTACCTTCGGAAGATCAGTCAGTGCTCTTAACCACTGAGCCATCTCACCAGCCCCTGGAAAGCATTTTCTTAGG
ATTTTTTTTTAAATGAANTGTTAAACTTTGCTGTGAAAGTGACAGTANAATGGGATCAAAGGTTTAAATCTCANCCTTCT
TCANTGTGTGTCAGTCTCTGTGTATGTGACTCTGTCTCTCCTGTCTGTCTCTGTGTGACTGTTTCTGTGAGTGTGTCTGT
CTCTGTGGGGTGGGGCCTGAAAAAGGTTCTCATGTGTTACAGACTGGGCTCANAANTGGCTTTGAACTTGTGATCTTTCT
GCCCATGTCTCCCACGTGCTGCTGAATTATAGGTGTTTCCTACCTTGCCNGATTTANGTNNNNNAGGCTAGAGAACCCAN
Sequence Type genomic DNA
Unitrap ID UNI29650

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115499191..115499589 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]


Sequence tag IST15094E1BBF1
Sequence
AACTCAGTACCTTCGGAAGATCAGTCAGTGCTCTTAACCACTGAGCCATCTCACCAGCCCCTGGAAAGCATTTTCTTAGG
ATTTTTTTTTAAATGAAGTGTTAAACTTTGCTGTGAAAGTGACAGTANAATGGGATCANAGGTTTANATCTG
Sequence Type genomic DNA
Unitrap ID UNI29650

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115499191..115499341 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]

 
Come back to gene ENSMUSG00000029550


For any suggestions or comments, please send an email to unitrap@crg.es