Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14341D2
Clone ID IST14341D2
Vector VICTR74
Project tigm

Sequence tag IST14341D2BBF1
Sequence
ATGTTTAGGGGTGGCAACTGGGGAACACTCGAGGACCCCACAGCATGGCCCTGGGCTTAAGGTTGGCTTCAGGCTAGAGT
ACACCTTAAGCCAGTGAGTGACCCAAGACTTAATCCCTAAAAGCACCGCTGGGGCTCTTCCTACCCGGATGTGTACTGGG
ACTATGGGGAGCGGGGCTGACAGCAGAACTGGTTCATCCAGTGGCCCTTACCCANTGTTTTGGAGCCTGACCTCTGGTGG
AAAGGCTGGAGGAACTGCTCTGGGGCNACTTTCACTGANGCTAACANGGAAAGCACAGTACTGCCTGCCNNGCAGGTCNN
CNCTGGGCACANGGCNNANTCTTGTCTNNNNNTGGAACTCNNGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14341D2HMR1
Sequence
ACATCAGTGGTCACACTACACAGGTTTCTGTCCTAGGTCACTGAGGAAAACTGTGCANTCCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI33700

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75467158..75467222 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017774 (Myo1c) NM_001080775 myosin IC Gene [Source:MGI (curated);Acc:Myo1c-002]

 
Come back to gene ENSMUSG00000017774


For any suggestions or comments, please send an email to unitrap@crg.es