Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11271A1
Clone ID IST11271A1
Vector VICTR76
Project tigm

Sequence tag IST11271A1HMF1
Sequence
TTCCGAAGGTCCAGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCCATAACAAGATCTGACTCCCTCTTCT
GGAGTATCTGAGGACAGCTACAGTGTACTTACATATAATAAATAAATGAGTAAAAAAAAAATTTATTNAAAAAANAAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130183226..130183384 153
NO GENE  


Sequence tag IST11271A1BBF1
Sequence
TTCCGAAGGTCCAGAGTTCAAATCCCANCNACCACATGGTGGCTCACAACCATCCATAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI9754 UNI30629 UNI31200 UNI31201 UNI33691 UNI35254

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 89592492..89592559 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61181412..61181479 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020085 (Aifm2) NM_001039194 apoptosis-inducing factor, mitochondrion-associated 2 Gene [Source:MGI Symbol;Acc:MGI:1918611]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 32517618..32517685 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020272 (Stk10) NM_009288 serine/threonine kinase 10 Gene [Source:MGI (curated);Acc:Stk10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52985723..52985790 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035181 (Heatr5a) NM_177171 HEAT repeat containing 5A Gene [Source:MGI Symbol;Acc:MGI:2444133]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 73376068..73376135 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 42311785..42311852 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 96248553..96248620 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32796651..32796718 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 88846443..88846510 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 142339948..142340015 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 107535567..107535634 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028613 (Lrp8) NP_444303 low density lipoprotein receptor-related protein 8, apolipoprotein e receptor Gene [Source:MGI (curated);Acc:Lrp8-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 141171260..141171327 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036555 (Iqce) NM_028833 IQ motif containing E Gene [Source:MGI (curated);Acc:Iqce-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72736111..72736178 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16983792..16983859 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 64829286..64829353 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109866109..109866176 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71521020..71521087 64
NO GENE  

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es