Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12380A10
Clone ID IST12380A10
Vector VICTR76
Project tigm

Sequence tag IST12380A10BBF1
Sequence
AACCCACTTTCCAGTGATAGCCCGTATAAAAGGCTTGGTGATGTACACCTTGATTCTAGCATTCAGGAGGTAGAGGCAGG
TAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53164428..53164514 87
NO GENE  


Sequence tag IST12380A10HMF1
Sequence
ATCTTTTCCTCCCTCCACCTGCTCACCCGAAGCCCCTAGGTGCATCCAGCCTCTCACACCANACAAGGATGGGACCCCAG
GGTGGAGGGAGGTNCCCTN
Sequence Type genomic DNA
Unitrap ID UNI13503

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3367180..3367277 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069806 (Cacng7) NM_133189 calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]

 
Come back to gene ENSMUSG00000069806


For any suggestions or comments, please send an email to unitrap@crg.es