Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0620
Clone ID XT0620
Vector pGT0lxf
Project sanger

Sequence tag XT0620
Sequence
GTTACCTGGCAAGATGGCGGCGCCCAGAGCGGTAGGTGACCGCAGCGTCCGCGTCCCGGAACTATGGTTCACTTTGTAGC
TCGGTTCTCGAGACCTCTCTCAGCCTCCTGGGAAACAAAAGTCTGCGGAAACAGAGCGTCTCCTGCCGGACCTCGCTCGG
GAGACGCCGTCTGGGGCTGCCGAGGGCCACAGAGAGTCTCGAGTCGCTTGATA
Sequence Type mRNA
Unitrap ID UNI3358

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26404449..26404661 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057229 (Atp5sl) NM_025504 ATP5S-like Gene [Source:MGI Symbol;Acc:MGI:1913599]

 
Come back to gene ENSMUSG00000057229


For any suggestions or comments, please send an email to unitrap@crg.es