Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13589B11
Clone ID IST13589B11
Vector VICTR74
Project tigm

Sequence tag IST13589B11HMF1
Sequence
CCTTCTAAAAACAATTCCCTGGGTTAAAGAAACTGAGGTCATAGGAATTCTTGTTGTTTTGTTTTCTTGGAATTTTCTGC
CCCAGCCCTCACATGACTCTGGGTCCTTGTCCCGACCTTGTACTTTGCATAANGACACTTNNNGGCTATTCCNCNTTTTA
CCATCCCNGCCTTTATGTAAATTACNACNGTANCCCNNNGGCNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13589B11BBF2
Sequence
GTGCCACGCGCCACACCATGCTCCTAGCCGCTTTCCCCTGACTGATTGGCACCTACTTTCTTCCCCCTCACGACCCAGCA
CAAATTATGCAGCCATCGAGCCTGGGCTCCCATTCTTTCANAGCCACTTATTANCTGAGTGACCTGGGTAGTTAATAGCC
AGTTTTCTCACTCGTAAATGAGGATAATGAGAGGATAGCTTANAGACTTAAATGGGTTAATATATAATATAAAGTCTTTA
NAATGGCAAGAACTANGAAGGAGCAGGAAATAGAGAGGGCTCANCTCCTGTCCAGGAANACTCTCTTCCCTCTGCATCTT
CNGTGGCANANANACACAAGGGAACTCTCTGAANTGTCTTTTANCANGNNNGN
Sequence Type genomic DNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126805973..126806338 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]

 
Come back to gene ENSMUSG00000025405


For any suggestions or comments, please send an email to unitrap@crg.es