Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14401C8
Clone ID IST14401C8
Vector VICTR74
Project tigm

Sequence tag IST14401C8HMF2
Sequence
ATCACCAAACAGATCTGCTGCTGTAGCCGTGTGGGCAAGGCGTGGGGCCGAGGCTGCCAGCTCTGTCCACCTTATGGTTC
AGGTGAGCAAGTCCTTCCAACTCATCCCTTCCTAACAGACCGGAGTCATAGGCCCTGCCTTCAGTCTCCAACGTTGTCAG
TACCTTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI32233

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28113116..28113286 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]


Sequence tag IST14401C8BBF1
Sequence
ATCACCAAACAGATCTGTCGAGGTCGATCGACGGTATCGATTAGTCCAATTTANNGCCAGCTCTGTCCACCTTATGGTTC
AGGTGAGCAAGTCCTTCCAACTCATCCCTTCCTAACAGACCGGAGTCATAGGCCCTGCCTTCAGTCTCCAACGTTGTCAG
TACCTTGGCCACACTCCCAAGGCTTCATCAGTTCTGGGCTTCTCCTCTATCCTTAGCCACGCCCATCCCTGAAACTTACA
ACCTTTAAGTTAGCCTGACCAGAGCACTCCGCCATCATCCCCTAAAGAGGAAAACTCTCACGGCTCCNCCATTGGCTTCT
GAAACATCTAATTCTTTGGTCNGTACACTACTCCNTCCAGCATATNAGCNNGACTCCCGACACTATCTNACNCNNNGCTT
TGTTCCCAGCCNAGGCCTACTTACCACTCNCNAGACTNNNTTGGTCTCCTCTCCTGCCTTCTCCN
Sequence Type genomic DNA
Unitrap ID UNI36327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28112822..28113286 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es