Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14640B2
Clone ID IST14640B2
Vector VICTR74
Project tigm

Sequence tag IST14640B2HMF1
Sequence
CCCTGTCTCAAAAAACAACAACAAAAACAAAAAACAGACATCTACTGTTTAATTCTGGTTATCTGAGATAGAGTTAAGCT
CATAGACAAATAAATAGAAGTATCTGGGGGTAGGAGAAGGATTAAATATGTTTATGGGAACAGAATTTTGGTATAAAAGA
AAAACATTTTAAAATTGTCCTAAAAAGAATTAAGAACTGATACCTTTCCCCTAAATTGTGAAAAATATTAATCTATGTAT
CTAACAAACTCAAAACCCTGTGAGTATAGTAACTGTAAACAGAATCACTGAAAATCAGAAAGATAATCTTCAAACCAACA
AGACAAGGGATGTAGCTCAGTTGGTTGAATGCTTGCCTAGCATACACAAGGTCCTTGGTTCCATCCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108508035..108508422 388
NO GENE  


Sequence tag IST14640B2BBF1
Sequence
CCCTGTCTCAAAAAACAACAACAAAAACAAAAAACAGACATCTACTGTTTAATTCTGGTTATCTGAGATAGAGTTAAGCT
CATAGACAAATAAATAGAAGTATCTGGGGGTAGGAGAAGGATTAAATATGTTTATGGGAACAGAATTTTGGTATAAAAGA
AAAACATTTTAAAATTGTCCTAAAAAGAATTAAGAACTGATACCTTTCCCCTAAATTGTGAAAAATATTAATCTATGTAT
CTAACAAACTCAAAACCCTGTGAGTATAGTAACTGTAAACAGAATCACTGAAAATCAGAAAGATAATCTTCAAACCAACA
AGACAAGGGATGTAGCTCAGTTGGTTGAATGCTTGCCTAGCATACACANNGTCCTTGGTTCCATCCCCAACACAAGACAA
AAATAAACAAAAGAAAAACANGTNCACACCTGTAATCCCACTACTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108507977..108508422 438
 
EST/CDNA Est Name
  CF895920.1


Sequence tag IST14640B2HMR1
Sequence
AGGGTTTCTCTCTATAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACNNGGCTGGCCTCGAACTCAGAAATCCACCTGC
CTCTGCCTCCCAAGTGCTGGGATTACAGGCATGCGCCACCACACCCGGCTAGATGTCTGTTTTATTTGGATTGTTTTGCT
TATGGTAATGTTTTCAAGGCTCCATGTTGTANCATGGGCATGTTTCCCANAGTTTGTTATTTTTAGACATTTCAAACAGG
TTTCCTTTGTTCTTANCTAANTTACTGANACTTTAATCCCCATTTTCACTTTCTGTTTTTTNACTAAACTTTTATGGTCT
CTTATTTATATAGTTTTACATATTCTTGANTGTTN
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108508419..108508772 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es