Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14947D3
Clone ID IST14947D3
Vector VICTR76
Project tigm

Sequence tag IST14947D3BBF1
Sequence
TTCTAGTAATAAAAGAGTGACTAAGTTAACCAGCTGTCATTGCTGTTGGTACTGAATAGTACAGAATAAATTTGAGGACA
CTTACTGTTATTCCCAAACATACCCACAAGTAGAACAGATAGTGAAAATTTAAAAAACAGAATGAATAGATGTGTGTGTA
GATTTTCATTACATTTATAATAGTTAAGAAAACAAGCTGCATAGGTGAATTATGTAGATATTATAGGTAATATAATAAAT
GCAGTTCCACAATGCAGTATATATGCTATCTTATCTTATGTTTCTATACATTTTCCATACAAAGAAATGATCATGGAAGG
AANCACACTGCATTGTGGGTAGTGGTTAGGTTNGAAGAANGGANNCNNGGGGATNANANGAGGN
Sequence Type genomic DNA
Unitrap ID UNI8136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28087018..28087400 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]


Sequence tag IST14947D3HMF1
Sequence
TTCTAGTAATAAAAGAGTGACTAAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14947D3HMR1
Sequence
TAANATGCTTGGGATAGTTTAGAGATTGGCTTATGTCTCATCATTTCCCTAGCACAGATGGTCCCTTTGTAAGCCCAGTC
ACCACTCACTGTTCTGTACACATANAACCCTCTAAGAAATGTATCAATTCCAAAACGCAGTAGGGGTGGCTAACAAGCAG
GAATAGGAAGGGATCCTTGGTANCTTGTTTTTTGTCTGTTGGGATCTGANCTTTGTATAACANCCACTTTGGTGTATANT
CATTTCTAGTTCGGTAGTTTTCTTAAATAAATTGAGGGAGACCTTGGGCTGTTCTTGACCTTGAGTGATTTAAAGGTTAT
GGGGAGGATTTGACTCTAGCCNGCCNGCCATTTNANCNNCTCACATGTGANGGTGCNNNTNNCNTGNANATN
Sequence Type genomic DNA
Unitrap ID UNI58

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51413512..51413887 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020358 (Hnrpab) NM_010448 heterogeneous nuclear ribonucleoprotein A/B Gene [Source:MGI (curated);Acc:Hnrpab-003]

 
Come back to gene ENSMUSG00000020358


For any suggestions or comments, please send an email to unitrap@crg.es