Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12422B2
Clone ID IST12422B2
Vector VICTR76
Project tigm

Sequence tag IST12422B2HMF1
Sequence
CTGCCTCCCAAGTGCTGGGATTAAAGGCGTGTGCCACT
Sequence Type genomic DNA
Unitrap ID UNI1910 UNI36330

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6979201..6979238 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 14458920..14458957 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 30815886..30815923 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 58630345..58630382 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49204453..49204490 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 41623669..41623706 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 45222388..45222425 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11183581..11183618 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8642259..8642296 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 11814259..11814296 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20304070..20304107 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20750249..20750286 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 69421837..69421874 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55442478..55442515 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 28259393..28259430 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 28747559..28747596 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001424 (Snd1) NM_019776 staphylococcal nuclease and tudor domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1929266]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 31322290..31322327 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28324673..28324710 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 31853084..31853121 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20007133..20007170 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037315 (Phf16) NM_199317 PHD finger protein 16 Gene [Source:MGI (curated);Acc:Phf16-001]


Sequence tag IST12422B2BBF1
Sequence
CTGCCTCCCAAGTGCTGGGATTAAAGGCGTGTGCCACTGCTGCCCGGTCANAATGTACTCTTAACCTCTGAGCCATTTCT
CCTCCCTGAATTGTCTGAAATTACATTTATTTGTTTGTTTGTTTATTGTGTTTGTGTGTATGTGTGTTTATATGAATGCA
CTCGTGTGAATACATACCTTTTACCTCATTGGTTTTTTTTGTCCTCACGAGGTCCAAAGGGTATATGGCTGCTGAAGGCT
GGTTGGCAACAGGCCAGGCCTTCCACCAAGTGTATTGAGTTGTGCTCACAAAGAGTTCCANACAATGTGACGGTACTGGC
TCCGTCCTCTGTTTCANGGTGANCCNCGCTTGNAGATGCTGTGCNCANAGGGTGGTGGCTGCCTGCCANANGAGGCTGTN
AAATGTNNTTGTCNNTTCCCANACNCNCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037315


For any suggestions or comments, please send an email to unitrap@crg.es