Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14731A11
Clone ID IST14731A11
Vector VICTR76
Project tigm

Sequence tag IST14731A11BBF1
Sequence
CTTTCAAAGACTACCTTTAAAAGAGGCATACAATAAAAAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAA
AGAAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGAAAGAAAGAAAGAGGCCAGGTGGTGGTGGCATACATCTTTAA
TCCCAGCCCTCAGGAGGCAGAGGCTGGCAGACCCGGGTGAGTTTGAGGCCAGCTTGGTGTACAGAAAAAGCCCAGTCTAC
AGGTATTTTGAATAGTCTGTGTCTTTTTTATTTCAAGAGGAAGGTGGGTTTCTTTAGCAAGCAAGAACAGCCAAAGCTAC
ACAGAAACCCTGTCTTGAAAAACTGAAAGGCAGACAACATACTACAACAATATTGAGACCTATGCATTTTAAAAGCACAC
CCTTAAATTCTACTGCCCCAAACCATTACTCACTGATAAGACAATCTTCCTGATGTTCTTCACATAGAGGGTCACGTAGT
CGTCAATGTACGTTTTCATGTCCCTGGGANTNACGTGGAACNNGTTCACGCTGANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135212231..135212764 526
NO GENE  


Sequence tag IST14731A11HMR1
Sequence
GAAAGATNATTTAAATTCNGAGTATTTCATTATAATGCGCTAGGAACCTTGTCTGTATGGGTTGTGTGTAGATTTCTTAN
ATGATAAACTGTTGGGAACTAAAAAGGGGGCCCAGGAGAAAGGAGGGGAAACCCACACCCCACTAGAGTTTTACCTATTC
TCTGGTCTGTCAGGCGTGGGAGAGCTGCCATACACTTTCCACTCANCCCTGGGTGGGCATTCAAGCCTCTGACCCATTCT
TCAGGGGGT
Sequence Type genomic DNA
Unitrap ID UNI9669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135212760..135213008 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es