Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14395B11
Clone ID IST14395B11
Vector VICTR74
Project tigm

Sequence tag IST14395B11BBF1
Sequence
AGTGTAGGAAAATGTCCTATGTCACCTTATATTACTACTACTGGAAAATTTGCAAATAAGCACACCTTCTTGCTAACAAT
TTGCAATAATACATTAAAAATGTACTATGCAGGGACACACACATGCTTAAGTGTGTTTATGTATGTTCTATCTAGTTTTT
GTGATATGAAGATATAAACATTATTTGTAAGACAGTAGTTAACCTAGGTAAGTCACCAAGAGGGTAAAATATGAAAATTA
AGTCACTGGTTCTTATGTGTGTGTGGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70337095..70337403 309
 
EST/CDNA Est Name
  CJ076210.1 - BY217457.1 - CJ165611.1 - CJ171247.1 - CA883725.1 - CJ161536.1 - BY213411.1


Sequence tag IST14395B11HMF1
Sequence
AGTGTAGGAAAATGTCCTATGTCACCTTATATTACTACTACTGGAAAATTTGCAAATAAGCACACCTTCTTGCTAACAAT
TTGCAATAATACATTAAAAATGTACTATGCAGGGACACACACATGCTTAAGTGTGTTTATGTATGTTCTATCTAGTTTTT
GTGATATGAAGATATAAACATTATTTGTAAGACAGTAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70337095..70337294 200
 
EST/CDNA Est Name
  CA883725.1


Sequence tag IST14395B11HMR1
Sequence
CACTGTATTCNGTGGATTTTGCANAATTTGTCNGTGGAATCCCAATGGAATGANAAGCTATTGGCAAGAGGATCTCTGTC
TCTAAATTATCTCCTACCTTTTCTACAGCCTANGGAAGCTTTGTAAACAATACCTCTATGCATGCATGCATGCTTGCTTG
CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTN
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70336886..70337098 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es