Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10543B12
Clone ID IST10543B12
Vector VICTR76
Project tigm

Sequence tag IST10543B12HMR1
Sequence
GCTAGCCTGGGCTACATAGCAAGTTCCAGAACAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26653039..26653073 35
NO GENE  


Sequence tag IST10543B12BBF1
Sequence
ATAAGGCAAGAGCCACCATGGCTATGTTCACATTGCTGTCCNNCAATCTCGGGATCTTCCGCCTTCCCTAATTGATAGCC
TATTACCAAGTAACCAGCTTTTGCTGTATTATTTTATCTTAAGGCATTTTATTTTGTGTATTTTCATAATGCAAAATAAN
GGACTTTTTTATTTTTTTAAAGGCAAGGTCTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI16727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26653115..26653312 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es