Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10673D10
Clone ID IST10673D10
Vector VICTR76
Project tigm

Sequence tag IST10673D10HMF1
Sequence
TCAGGACCTGTCAATCACTCGCCTCCACCCCCATCTCAGAAACAGANCTTCCCTGTGTAGCTCTGGCTGGTCAGGGACTC
TCTAAGTAGGCCAGGCTGACCTTANAATTCCCAGAGATCCTAACTGCCTCTGCTTCCCAAATGTCAGGATTAAAGGTATG
TATCACCTCAGCAGTGGTGGCAAATGCCTTTAAACACCAGTGGTCAAGGCAGAGGCAGGCAGATCTCAGAGTCTGAGGTC
ANACTGGCCTACANAGTGAGTTCCAGTATANCCAGAGCTACNCAGANAAACCCTGTCTTGAAAAATCNNNCNNNNNCNTA
TCCCGACCCTANTGTGTGTGTATGTGTGTGTGTGNGACCCANATGGTCCTTTGTCNTGNNGNNNTGTGTGTTGNAANANN
TN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10673D10HMR1
Sequence
CTGACAGCCCAAAGTGAGAGTGAGCAGATTTTGGCAGAAGCAGAACTGAAGGGAGACAAATGAGGATGCTATGATTTATA
AGGGCCTTCTTGCAGTAGTGTGCGAGGTTTTCAATAACCATCTACTCGTCCATCCTTAAAGGTAGACATTANCTGTCTTT
ATTTTGTGAATGGGGAAAACCAGTTGTAAAGATGTGGTATCGCACCCANCTTGAGCTGTAAGAAGTAAGAGTGGAAAGTA
NAGGCAGCACTCCCCGCCTCCAGTATAACAACCTCTGCGCTCCGTGGCAGGCCTGCCTCTTGTTCCCTCCTCTCCTGANN
NGCTTTTANCANTTC
Sequence Type genomic DNA
Unitrap ID UNI9576

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46250768..46251101 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023967 (Mrps18a) NM_026768 mitochondrial ribosomal protein S18A Gene [Source:MGI Symbol;Acc:MGI:1915815]

 
Come back to gene ENSMUSG00000023967


For any suggestions or comments, please send an email to unitrap@crg.es