Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14818D11
Clone ID IST14818D11
Vector VICTR76
Project tigm

Sequence tag IST14818D11BBF1
Sequence
CTGCCCAACCTCTCTGGATCTGTGTTTTTACATAAAAGAGAGGTAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 42057348..42057398 51
NO GENE  


Sequence tag IST14818D11HMR1
Sequence
GGCAGCTTCCCCTAAGTCACACAGTGAGTTAGAAGTGCAACTGAGGTTGGAATCCGGTCTCTTCCCCCTTGTTACCACAT
ACCCCTTTATGTAAGAGGAGCCACAGGCGCAGTTGTTAATGAAGTGGAAACTCTANTTGGAGTTTCCTGTCTGCTTTGAC
ACTGAAGGTGTGTTGTTTTGCTTGTGTAAACTGGGAAGGAAGATGGGGAGAAGCACAGGGGAAGCTGGGAAGGATGTGTG
TGTGTGTGTGCNGNACANGATGACTTGTGCANNCNNAANCGTTTTTATGGGANGATGGANTAAAN
Sequence Type genomic DNA
Unitrap ID UNI14313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 42057394..42057697 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025171 (Ubtd1) NM_145500 ubiquitin domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2385092]

 
Come back to gene ENSMUSG00000025171


For any suggestions or comments, please send an email to unitrap@crg.es