Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12408G10
Clone ID IST12408G10
Vector VICTR76
Project tigm

Sequence tag IST12408G10BBF1
Sequence
TTTGCTATACTTGCCAGGGGCCTCAGCCAAGCCTTTATTCTTTATAAGGTTTCAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI14249

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7768364..7768422 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031168 (Ebp) NM_007898 phenylalkylamine Ca2+ antagonist (emopamil) binding protein Gene [Source:MGI (curated);Acc:Ebp-001]

 
Come back to gene ENSMUSG00000031168


For any suggestions or comments, please send an email to unitrap@crg.es