Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST441753
Clone ID OST441753
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST441753
Sequence
GACTGAGCTTACCTAGAGCCGCCAGTGAACTGAATGAAGCTCTAGAGAGATACGGACTTTCTTGTGAGGATTTCTTCATA
CTGAAGCATGGAGAGTCGAGATACTTGAATACCGATGATAGAGCTTTTGAAGAAACATGAAACTAGGAATTTTCAGTGAC
AACAAAAGACTAAGAAATTCACAAATATTATGACACNTTTTCACATGGAAACAA
Sequence Type mRNA
Unitrap ID UNI17494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21170973..21171178 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044968 (Napepld) NM_178728 N-acyl phosphatidylethanolamine phospholipase D Gene [Source:MGI Symbol;Acc:MGI:2140885]

 
Come back to gene ENSMUSG00000044968


For any suggestions or comments, please send an email to unitrap@crg.es