Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14738G12
Clone ID IST14738G12
Vector VICTR76
Project tigm

Sequence tag IST14738G12BBF1
Sequence
TAATAAGATCTGTCGAGGTCGATCGACGGTATCGATTANTCCAATTTANTNNGGTATCGTGAAAANCNGTCNTNNGGNAN
TNNNTACCATTATNCTCNTGATCCACTGAGCCTGTGGCTCCTGGCNCCANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14738G12HMR1
Sequence
CCNTCATTCATCCCTTCNGANATTTGAGTATAGTAATCTGACATTCAGGCAACTAGTAATCAGTGTATTATAATGGACAG
TAAAGATAACTTTTTAGTGACCTCATGTCATGTCTACTCAGTTGGGGAACTGGTCCTGGACACATGCCTTCTTCTACAGG
GTTTTTAGAGAAAACAGCANAGCTTGTGATGATCCTGTGTGTGCGTGTGTATATGANANAGAGAGAGAGAGACGGGGTGG
GGGAGGAGTAGGGGGTGNNCN
Sequence Type genomic DNA
Unitrap ID UNI16111

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65531409..65531665 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040652 (Oaz2) NP_035082 ornithine decarboxylase antizyme 2 Gene [Source:MGI Symbol;Acc:MGI:109492]

 
Come back to gene ENSMUSG00000040652


For any suggestions or comments, please send an email to unitrap@crg.es