Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10287A12
Clone ID IST10287A12
Vector VICTR76
Project tigm

Sequence tag IST10287A12HMF1
Sequence
TGATAATACCANGCAAGTACCCCTAGGCCCTCTCCACCTGAATGGTATGGAGCTAGTATCTCAGCCTGTGGTAAGATAGC
TTCTCCTTAAAGAGAAGCAGAAGCCAGAAGCACCCATTTGATGACTCAAGTACACTTCTCATGTCTGTAGTCATTTCATC
ATTTTAAATATGGACAGGATGGTTCAGGCTATGATCTATAAAACTTCCGTAATTTANTACCTTTAAATAGTGTCCATTCC
TCCTCTTATCANCCGGCACACTGGTTGGGAGGCAAAGCCTTATGTGTGGGTGTGTTGTTCTGTTTTTCTGCCTTTTTCTC
CCTTTTGAGATAGGTCTCANTACATGGCCCAAACCAACATCCAAAGCCTANGCCTCAATGACAGTACCTGNNTCAGCTGC
TAAGTAGCAGGGGCTGCAAGTATACNATACTATGCTNAGCTCTTCACGTTACTTTAAAAAAAAAANACTTGCNNNGNCTT
NAANNTN
Sequence Type genomic DNA
Unitrap ID UNI22235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21517720..21518202 453
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039357 (Fut11) NM_028428 fucosyltransferase 11 Gene [Source:MGI Symbol;Acc:MGI:1920318]


Sequence tag IST10287A12BBF1
Sequence
TGATAATACCANGCAAGTACCCCTAGGCCCTCTCCACCTGAATGGTATGGAGCTAGTATCTCAGCCTGTGGTAAGATAGC
TTCTCCTTAAAGAGAAGCAGAAGCCAGAAGCACCCATTTGATGACTCAAGTACACTTCTCATGTCTGTAGTCATTTCATC
ATTTTAAATATGGACAGGATGGTTCAGGCTATGATCTATAAAACTTCCGTAATTTANTACCTTTAAATAGTGTCCATTCC
TCCTCTTATCANCCGGCACACTGGTTGGGAGGCAAAGCCTTATGTGTGGGTGTGTTGTTCTGTTTTTCTGCCTTTTTCTC
CCTTTTGAGATAGGTCTCACTACATGGCCCAAACCAACATCCAAAGCCTANGCCTCAATGACAGTACCTGCCTCAGCTGC
TAAGTAGCAGGGGCTGCAAGTATACNATACTATGCTNANCTCTTNACGTTACTTTAAAAAAAAAANNCTTGCNCTNGNCT
TTAATNTCN
Sequence Type genomic DNA
Unitrap ID UNI22235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21517720..21518206 458
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039357 (Fut11) NM_028428 fucosyltransferase 11 Gene [Source:MGI Symbol;Acc:MGI:1920318]

 
Come back to gene ENSMUSG00000039357


For any suggestions or comments, please send an email to unitrap@crg.es