Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13321H8
Clone ID IST13321H8
Vector VICTR74
Project tigm

Sequence tag IST13321H8BBF1
Sequence
TTATCAGGAAGTTCTAATGAACACCTGGATCTGCCTAATTANTCTTCTGCTCAACAACCTAACTAACTGCCAGGAGCCAN
AGGCCGGGGCGTCTGCTCTCCAAATGCANGCTGTGCTCCCACCTAACCTAACCAGCCCCTCTTTTCTGANGCTCTGGTCT
TTGGGCTGCTGCTCTTCTTNNNNCCTCTTCCTTTCAACCANACNNGGTTTCTCTGTGTCNCCCTGGCTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13321H8HMF1
Sequence
CTACAGAGGACCTGGGTTTGATTCCCAGCAACCACATAGTGGTTTACAACCACTGGCAACTCCAGTTCCAAGGGATCTGA
TAGCTTCTCCTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI15045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165685615..165685710 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es