Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11418D9
Clone ID IST11418D9
Vector VICTR76
Project tigm

Sequence tag IST11418D9BBF1
Sequence
CTACCTGAAGGAGTTTCACCTCTCTCCCAGCTCTCCCCCANTGCAGCAGGGCTGTGGGTCACAAGTGTTTAGCCAGGAGC
TGAAAGTTGGACAGTGATAGGTAATTCACAGCTTTCCCCTTTACCCACCCCCACCCTAAGGCCCAAGTACGCCCTCCTGG
ATGANTGCACTANTGCCGTGAGCATTGATGTGGAAGGCAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI36333

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 70982302..70982506 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031378 (Abcd1) NM_007435 ATP-binding cassette, sub-family D (ALD), member 1 Gene [Source:MGI (curated);Acc:Abcd1-001]

 
Come back to gene ENSMUSG00000031378


For any suggestions or comments, please send an email to unitrap@crg.es