Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11608F2
Clone ID IST11608F2
Vector VICTR76
Project tigm

Sequence tag IST11608F2HMR1
Sequence
CTCNNAAATCCNCCTNCCTCTGTCTCCCAAGTGCTGGGATTAAAGTCGTGCGCCGCCGCCACCACCACCACCTGGCTGAC
TTTCACAAGTTTTAAGACTAATTTTTAAAATCCTAGATACAGTTGATATTCACACATGCAGGAATTCATTACGGTAGTTA
CTTCCCANCTNCCTGGANTTTACCTATTCATTTTTATATCTATACTGGCAGAGTTACATT
Sequence Type genomic DNA
Unitrap ID UNI12335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127385882..127386101 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031984 (2810004N23Rik) NM_025615 RIKEN cDNA 2810004N23 gene Gene [Source:MGI Symbol;Acc:MGI:1913773]

 
Come back to gene ENSMUSG00000031984


For any suggestions or comments, please send an email to unitrap@crg.es