Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12860B8
Clone ID IST12860B8
Vector VICTR76
Project tigm

Sequence tag IST12860B8HMR1
Sequence
AACCCACCTTTTGTACATCTTTTTNNGAGGATATCTTCTACTTTTAAAAAAAAAAGTTACTAGGTCAGCANGATGACTCA
NCAGATGGCTCANGCNCTTGCCACAAAAGCCAANTGACCCATCCNANTTTGACTCCCCCAAGCCCACGTAAAGACAGGAN
ACAAACAACCCAATGAAAATGGCCNCNGACCCCCACAANTACACCCACCTCNNNATAATAATGGTAANTNTNTTTTTAAA
ANAAANCTNTTGCCNNGCNNGNTTTTTGCNCCTGTGTAATCCCATCNTTNNGAAAGTGAANCAAAGTGATCNNACTGAGG
ATANCCTGGGCAACCTANTGANCTTCNNCCTAATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12860B8HMF1
Sequence
GGTTTGGTGGTGTAGGCTTTGATCTCACCTACTCTAGAAGAGGATCAAAATTTAAAATCTGCCTGGTCTATAGAGGGGGT
ATTTAAAACTAGGATGAGATGGGCAAGTTGGTGAGAACCTGTTTCAAAAAAAAGTACAAAAAGGTAAGGCTGAGTGAGTG
CTGTCCCACACGTGAGGCTGCAGGTTATTCTCCAACGTGACAAAGGAAAAGAGTANTTTGCCAATGTGAATATGCAATAT
AGTATACTATTTACTTAATGGAAAAGTGAAATTATAGGTGATACTCTGGGATATNANTTA
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34925775..34926073 293
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es