Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14971E5
Clone ID IST14971E5
Vector VICTR76
Project tigm

Sequence tag IST14971E5HMF1
Sequence
GGTTGGCTAATTGGAGTTAAAAGCAGCCCATACAAAACATGACAAATTATATAATGGGATTATTGGCTGGAAAAGAGACA
TAATAACATGTCTGCCCAGCTCTTGTTCGGATTAAGGCTTGTTATAAATTANNNGTCNNANGTGTCTTTTATCCAGAAAC
TAAATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 126325..126491 155
 
EST/CDNA Est Name
  BY063961.1 - BB583338.1 - CN527661.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 106793..106959 155
 
EST/CDNA Est Name
  BY063961.1 - BB583338.1 - CN527661.1


Sequence tag IST14971E5HMR1
Sequence
AACNANCNTGGCCNNNNNNCNNNNNNNTGNNNNNNCNGTGNNATTTANTCTGTATAATATGTTACTTGTATGTATATTTT
CAGGG
Sequence Type genomic DNA
Unitrap ID UNI22841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70321651..70321693 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es