Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10222A9
Clone ID IST10222A9
Vector VICTR76
Project tigm

Sequence tag IST10222A9BBF1
Sequence
ATGGCAAGGAGAGGGGCTCTTCTCCCTCCTNTGGGCCGCCCTCTNNNNNNNNNNTNTCCCTCCCCCCNNCNNATATTGNN
CCCTGTGGCCNTCCCTNNTTGCCNANNNCCTGNATGGGATANATGGTAACANGCTCTCACCATGCTNANGAAAGTAGGGA
GNNACCANCAATCTTCNNAAATGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10222A9HMF1
Sequence
ATGGCAAGGAGAGGGGCTCTTCTCCCTCCTCTGGGCCGCCCTCTCCCTCTTATGTCTCCCTCCCCCCACCAAATATTGGC
CCCTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI30653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4777928..4778015 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053550 (D430041B17Rik) NM_172737 RIKEN cDNA D430041B17 gene Gene [Source:MGI Symbol;Acc:MGI:3605641]

 
Come back to gene ENSMUSG00000053550


For any suggestions or comments, please send an email to unitrap@crg.es