Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12279H6
Clone ID IST12279H6
Vector VICTR76
Project tigm

Sequence tag IST12279H6HMF1
Sequence
TAACAAATGTTCCTTTCAGCTCTCTTTCTTGATAAAAACAAAAAGTGAAACCAGAGACTTTTACAGAGTTACTCGGGTTT
TTTTCCTCCTAACGTCTTACTTTTTTAACTTANCANTTATATTCCGGACAGTTGTGGCTCTTTTTTTACAGTGAAGGACT
TGGAGGCTGCNGGAGGGAANCGCGGTGAGGGTGGGGTGGGGATAGGCCTCTTAAGGCGGAACTCACAGGCTGCACATCTG
TTTTNAATGTTTTGTAAAANCCAANANCCTTCANGTAAAAACTTTCANTAAATGACACNAAAAGNANCTGGGTCCNGGAA
NTCACNCNCAGAAAANCCNCGGAAATCCCCANCCNGGGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12279H6BBF1
Sequence
TAACAAATGTTCCTTTCAGCTCTCTTTCTTGATAAAAACAAAAAGTGAAACCAGAGACTTTTACAGAGTTACTCGGGTTT
TTTTCCTCCTAACGTCTTACTTTTTTAACTTAGCAGTTATATTCCGGACAGTTGTGGCTCTTTTTTTACAGTGAAGGACT
TGGAGGCTGCAGGAGGGAAGCGCGGTGAGGGTGGGGTGGGGATAGGCCTCTTAAGGCGGAACTCACAGGCTGCACATCTG
TTTTCAATGTTTTGTAAGAGCCAAGAGCCTTCAAGTAAAAACTTTCAGTAAATGACACGAANAGGAGCTGGGTCCAGGAA
GTCACGCACAGAANAGCCNCGGAAATCCCCAGCCAGGGTGGCCACCAAGGGTGAGGAGGAAGTGCGTCTGGTTTTCACCC
TGGAGTTCCCCGGANCCCTGGANGAAAGCNCCGCAGGTCTGAGCANCCCTGAGCCGGGCAGGGTGGGGGNCAGTGGCTNA
GGCCTAGCTGGGGACNATTTAAAGGTATCGCNCCNCCCAGCCNCACCCCC
Sequence Type genomic DNA
Unitrap ID UNI36335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7872898..7873425 501
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032000 (Birc3) NM_007464 baculoviral IAP repeat-containing 3 Gene [Source:MGI (curated);Acc:Birc3-001]

 
Come back to gene ENSMUSG00000032000


For any suggestions or comments, please send an email to unitrap@crg.es