Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14437H2
Clone ID IST14437H2
Vector VICTR74
Project tigm

Sequence tag IST14437H2HMF1
Sequence
GTGATAAAGTGCAGACGCTCGGTATTTAGAAGTGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59561476..59561512 37
NO GENE  


Sequence tag IST14437H2HMR1
Sequence
ATCNCCAGGGACGCTTCCTCTTCGTTCCCCACCCCCAAGAAACTTCGTGAATTCGCCTCGGGCGATGTCAGATATTGTGT
AAGTGTANATTTCCGGGCGCTTTCAACTGCTCGGTTTAAATGGGGTCTGTGACTAAAAGGGGGAAAAAAAAAAAAAAAAA
AAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI36337

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59561311..59561480 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028382 (Rod1) NM_144904 ROD1 regulator of differentiation 1 (S. pombe) Gene [Source:MGI (curated);Acc:Rod1-001]

 
Come back to gene ENSMUSG00000028382


For any suggestions or comments, please send an email to unitrap@crg.es