Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST441661
Clone ID OST441661
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST441661
Sequence
GACTGAGCCTCCAACAGATCAGCCTCATCTCAATGGAGAACATCGTCCCCACCAGGAAGCCACACCCCCGATGCTCTGCT
TCCAAAGAAGGCAGCCCACAGTAGAGACAACAAGCCTTCCAGGCGTAAGTGGAAAGTGGAAAGTGGAGTGACTTCATGCA
GCTGTGACTGGCTCTTCCTCTCCTAGGACTCTGTATTCGAAAAGAGGTGTGAACACCCAGAGCCCAAAACACCTTCCTGG
GAGCAGCATGGAAACCCCTCAAATAAGTAGTCAGGAGCCTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI15860

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56982526..56982802 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]

 
Come back to gene ENSMUSG00000024207


For any suggestions or comments, please send an email to unitrap@crg.es