Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10053B3
Clone ID IST10053B3
Vector VICTR75
Project tigm

Sequence tag IST10053B3BBR1
Sequence
TTGTGAGCCTTTGTGTCGTTGTTGTGAACCGAATTTAGGACCTCTGCTTGCTCTGGTCGTCTCTGCTCACTCTAATAAAT
AAGTACACTGTACCTGTCTTCAGAAACACCAGAAGAGGGCGTCAGATCC
Sequence Type genomic DNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62241464..62241591 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


Sequence tag IST10053B3HMF1
Sequence
ACAACCATATGTATAGCTACGGTGTGTACTCATATACATAAAATAAATAAATAAATAAATCTTTTAGAAAAAATATTTCT
ATTATCAAAAAGCAAATATGGACAAGGATGTAGAAAAAAAACAAATTCTTGTGGAGTGATGGCAAGTATAGACTTGTATA
GATAGAATATGACAATTTTTTTTTTTTTTTTTTTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62241588..62241782 195
NO GENE  

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es