Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13152H3
Clone ID IST13152H3
Vector VICTR74
Project tigm

Sequence tag IST13152H3HMF1
Sequence
AAACAAAAAACAAAAAAACAAAAAAAGAGAATGAGACTAAGGTGTGGTANCGCANATCTTGTGGTAGACCAATTAAAAGC
CCTGGGTCTGGTCCTGAGAGGTATTTGAGTTGATCTCTGGCTCTGCCGTTCTCCTGCTCTTAAGGCAGCTCAACAGCAAT
GTCCTTGTCCACCTTACCACACCCTCCAAGCCAAGGTCANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 125285080..125285228 145
NO GENE  


Sequence tag IST13152H3BBF1
Sequence
AGGCTCTCTCATTGAACCTAATATACATTCATTTGTAGACTGGATGGGCGGTGCAGAATCCANAGCCTCCACCGCCCAAA
CACTGGGATTATAGGCATACACTTCCATGCCCAGTTTTAAGTATGTTCTGGAGAACTGAACTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI13008

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138040517..138040665 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037221 (Mospd3) NM_030037 motile sperm domain containing 3 Gene [Source:MGI (curated);Acc:Mospd3-001]

 
Come back to gene ENSMUSG00000037221


For any suggestions or comments, please send an email to unitrap@crg.es