Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14177B11
Clone ID IST14177B11
Vector VICTR74
Project tigm

Sequence tag IST14177B11HMF1
Sequence
ACTATTCTGTGTATGTTCCTTCCACAGATGCATGCTCAGTAGATTAAAGGGGATAGTCATTTGTCAGGCAAGGGTACTGG
AGCCGTCCTGTGCCTCTGCTAGAACCTCCAACCAAGTTCTCCAAAGGTCAGAGACAAGTGTGATGCCTCATCCTGCAATC
TCAGAACTGAAGAAACTGCCACAAGTTTGAAGCCAACTTGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86480420..86480622 203
 
EST/CDNA Est Name
  BQ878282.1 - CB573651.1 - CA949336.1 - CB317894.1 - BE650908.1 - BI646753.1


Sequence tag IST14177B11HMR1
Sequence
TANTGAGGGAGGAAAAAGACATCAACTGAATCAGCAGAGTCATCCTGACAATCAGTGGGTGACAAGATGTTGCAAGCAGG
TTACACTCTCATCTATTTTTCTCTTTTATGGGTGAATATTTTTATTATTTGAATATATACTTCTCCCCCCTTTTGAAATA
GACTTTCATTTANTCCAGACTGGCCTTAAACTTCCAATCCTTCCATCTCTGTGTCTCCCATGCTGGGGGATGCTTTGTGC
ATGCTAAGCAAGCATTCTGCTACNATCTGGCTATATCTCTAGCCCAGTATATTTTAAACATGAAAATCTTATCTTCTATA
CCCATGGCCTTTCAAGTCCTACATAAAGTCTTGGGTCTGTGACNTTTGANTTNATGTAATGAATTTATTTTCTAATANTG
N
Sequence Type genomic DNA
Unitrap ID UNI22837

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86480024..86480423 386
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018171 (Tmem49) NM_029478 transmembrane protein 49 Gene [Source:MGI (curated);Acc:Tmem49-001]

 
Come back to gene ENSMUSG00000018171


For any suggestions or comments, please send an email to unitrap@crg.es