Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12648G10
Clone ID IST12648G10
Vector VICTR76
Project tigm

Sequence tag IST12648G10BBF1
Sequence
TTAGTAAGGGCTTTTGTCCTGTGGCTGGCTAGCCTGATAGGAGACAGTGCCACTCTGGCTCCTCCCCCTCATCTCAGTGG
CTCCCCTTACTTCGTGTGTACTTGCTGTCTGCCTTCCTCAGCAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 168052313..168052441 129
NO GENE  


Sequence tag IST12648G10HMR1
Sequence
NAATATTGAAATATGCCTGTGTGGGACCCTTCACCCTGAAGCAGCCNACCCTGCTTCCCACAAAAAAACTAGGATGAGCC
CAAAATAGAAGAGGAATAAGCTGAGTAACCTTCAGACATGGTCCCTGCACAGCAGATTTTCTCTGGTTCTCAGGGATGAC
TGCCCAATCCCACTGCTTCTAGGTTGATGCCTCTCTTGGTTTGTGTCTACTACTTACAACTTCCTGCAAGCAGATCTCTG
ATCAGCGACCTTTTCACATGTCTTCCAGGAAGGCTCACACAGGATGACACACCATGGGCTATTTCTCTTCCTGCCATGTT
GCCACAGTCTTTAATGTGAGCTATTACTATCTTACATGATAAGCGCGGCTTTGGAAGAAGCGATCCCCCTGCATAGAGTG
AAGCTTAAACCNACCCTGATAAAACCNTTCCCAGTGGGGCTATTGTTGTTGTTGGTGGTGCTGGTGGTGGTGATGTGTGT
GTGTGTGTGGGGTCTGNATCNCNCNCNCTN
Sequence Type genomic DNA
Unitrap ID UNI9646

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 168051807..168052314 492
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026564 (Dusp27) NM_001033344 dual specificity phosphatase 27 (putative) Gene [Source:MGI Symbol;Acc:MGI:2685055]


Sequence tag IST12648G10HMF1
Sequence
TTAGTAAGGGCTTTTGTCCTGTGGCTGGCTAGCCTGATAGGAGACAGTGCCACTCTGGCTCCTCCCCCTCATCTCAGTGG
CTCCCCTTACTTCGTGTGTACTTGCTGTCTGCCTTCCTCAGCAGATCTGAGGAGCCCAACCACATCAGGGGACAGTTAAT
AAAACATATTCTCCAGGGCAGTATTTATACACACCCGACTTCATTTATCCAGCCTAGTGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 168052313..168052536 224
 
EST/CDNA Est Name
  BY337780.1 - BY341907.1 - BY340139.1

 
Come back to gene BY337780.1 - BY341907.1 - BY340139.1


For any suggestions or comments, please send an email to unitrap@crg.es