Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13960F6
Clone ID IST13960F6
Vector VICTR74
Project tigm

Sequence tag IST13960F6HMF1
Sequence
GGGTTTCTCTGTATAGCCCTGACTGTCCTGGAACTCACTTTGCAGACCAGGCTGGCCTCAAACTCAGAAATCC
Sequence Type genomic DNA
Unitrap ID UNI19577 UNI30261 UNI35091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 17992239..17992311 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69313985..69314057 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17567777..17567849 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 79758317..79758389 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059173 (Pde1a) NM_016744 phosphodiesterase 1A, calmodulin-dependent Gene [Source:MGI (curated);Acc:Pde1a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 70394589..70394661 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 46039287..46039359 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93118401..93118473 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109795334..109795406 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108261271..108261343 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013150 (Gfod2) NM_027469 glucose-fructose oxidoreductase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917825]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 12521455..12521527 71
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7564233..7564305 71
NO GENE  

 
Come back to gene ENSMUSG00000013150


For any suggestions or comments, please send an email to unitrap@crg.es