Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14282F6
Clone ID IST14282F6
Vector VICTR74
Project tigm

Sequence tag IST14282F6HMR1
Sequence
NTCATNATTTTTTCNNCAGATACTAANAGCAGCCAGCCAGTAAAATCATTTTTCGATTTTTTCCCCATCTTGTAGAAAGC
TTTGTGCACTGAATCACCTAATTCATTAAGAAAATCAAGGGCATTAGCTTCTTTAAGTTCGGAATATAGTTTCAACCATG
GGTCTTCAAAATTCTCTGAGCTCCCAGGAGGGAGAGAATCTGGAGAGGTTTCAATAGTTGAAAGTGCTGGTGGATCAACA
ANCCAATTCCANAATTTTAAAAGATTCATCCTTGTACTTCTGTTACTCTANAACCACTCCTGGTACCAACTTCTGTATTA
NTCAGGGTTCTCTAGAGTCNCAGAACTTATGGATAATTTCTAAATAGTAAAGGAATTTATTGATGACTTACNGTCNGCAG
CNCANNTCCCAACANTGGTTCAGTCNCANCTGTGAATGGAANTCCANGGATCTNNCNNTTACTNNNTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14282F6BBF1
Sequence
AATGAAAGGAAGGAGTTGTGTGATAAAATCGAAAGGCTCCAGACACAAGTAAACGATCTAAAAGTTGCTAAGTGTGTCCT
TGAGGAGAATCTTCTCTCTTGTAGCAATAGAGCTCAAGTTGCAGAAAATCAAACAGAAACTCTCATTGTAAGGTTGGCTG
AACTACAGCGAAAATTCAAGTCTCAGCCTCAGAGTGTGTCGACAGTTAAAGTAAGGGCTCTAATTGGCAAAGAATGGGAT
CT
Sequence Type genomic DNA
Unitrap ID UNI31001 UNI31002 UNI31003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11248643..11248883 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048960 (Depdc2) NP_001028808 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 Gene [Source:MGI Symbol;Acc:MGI:1923385]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51926373..51926613 241
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7486346..7486586 241
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 18970243..18970483 241
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 28713362..28713602 241
 
EST/CDNA Est Name
  BE333375.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8901011..8901251 241
 
EST/CDNA Est Name
  BY125477.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5632553..5632793 241
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11334250..11334490 241
 
EST/CDNA Est Name
  BB841171.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 9923927..9924167 241
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 53993876..53994116 241
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 44293800..44294040 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025202 (Scd3) NM_024450 stearoyl-coenzyme A desaturase 3 Gene [Source:MGI Symbol;Acc:MGI:1353437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 34785646..34785886 241
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 6910735..6910975 241
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 70134162..70134402 241
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7526298..7526538 241
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 61729599..61729839 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079548 (AC125119.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 11410955..11411195 241
 
EST/CDNA Est Name
  AA546950.1 - AI505898.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 77700423..77700663 241
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8049026..8049266 241
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166447: 45800..46040 241
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 48920644..48920884 241
NO GENE  


Sequence tag IST14282F6HMF2
Sequence
AATGAAAGGAAGGAGTTGTGTGATAAAATCGAAAGGCTCCAGACACAAGTAAACGATCTAAAAGTTGCTAAGTGTGTCCT
TGAGGAGAATCTTCTCTCTTGTAGCAATAGAGCTCAAGTTGCAGAAAATCAAACAGAAACTCTCATTGTAAGGTTGGCTG
AACTACAGCGAAAATTCAAGTCTCAGCCTCANAGTGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI31001 UNI31002 UNI31003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11248643..11248842 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048960 (Depdc2) NP_001028808 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 Gene [Source:MGI Symbol;Acc:MGI:1923385]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51926373..51926572 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7486346..7486545 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 18970243..18970442 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 28713362..28713561 198
 
EST/CDNA Est Name
  BE333375.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8901011..8901210 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5632553..5632752 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11334250..11334449 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 9923927..9924126 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 53993876..53994075 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 44293800..44293999 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025202 (Scd3) NM_024450 stearoyl-coenzyme A desaturase 3 Gene [Source:MGI Symbol;Acc:MGI:1353437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 34785646..34785845 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 6910735..6910934 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 70134162..70134361 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7526298..7526497 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 61729599..61729798 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079548 (AC125119.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 11410955..11411154 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 77700423..77700622 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8049026..8049225 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166447: 45800..45999 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 48920644..48920843 198
NO GENE  

 
Come back to gene ENSMUSG00000079548


For any suggestions or comments, please send an email to unitrap@crg.es