Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10893H11
Clone ID IST10893H11
Vector VICTR76
Project tigm

Sequence tag IST10893H11HMR1
Sequence
TGAGAAGAGGCGGCGAGGNCAGCGCAGGTGCAGGTGCCCTGAGCACCAGCTGCGCATGTTGAGCCACTCTACAGTGCGCG
TGGGACCAGGGCCTTCCTCCCGGTGCAGCAAAACCAGTTGCTTCAAGGCACGGACAGCAGTGTTCTCTAACATTTGCTCC
AGCTATGGAAGACAGAGACAGGTGGAGGTCATTGATACCTTCTCTACCCACACCCGGCAAAGCTCANCTCCCTCACAGAA
CAGCAGCATGAGTGTACATGGCCTTCCACANGCACNGANNGACAAGGGANNANNNCNNGANGGGANNANTGANGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10893H11BBF1
Sequence
TCACGGCGCAGCCCAGCGAAACTTGTAAGGGGTGGGAACCTAAAAAAGGAACCCAGGGGAACAATCTGTCTTCTACCTCA
GGGGTCGGGTTTGGGTGTAATATGAANAANAGCCTTAGGAAACACACCTAATGCTTANGTGTATAATTTGAGGGATACTC
TCCTCCAGTGGGGGTTGGGGCCAGAGAATAACTGTTCTTCCATCTGGGACCGAGGCTTGGGCGTGGCTTGAANAAAGGCC
CTGAGTGGCACGCCTNTGCTGCTTCCTGTTCCAGTTNGGGGACACACCCCTTTGCCTGTGGGCGTGGCTTGGTGTNNCNC
CCTCTTCCACCTTGAGTGGCATTTGGTACATCTGCCAAAGGTTGTANTTTANGGGTACAGCATGCCCCACAGTCGGGCAG
GACCANGGCTTGN

Sequence Type genomic DNA
Unitrap ID UNI36339

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3535979..3536390 388
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004565 (Pnpla6) NM_015801 patatin-like phospholipase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1354723]

 
Come back to gene ENSMUSG00000004565


For any suggestions or comments, please send an email to unitrap@crg.es