Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13038A6
Clone ID IST13038A6
Vector VICTR76
Project tigm

Sequence tag IST13038A6BBF1
Sequence
AGAGGAGTATGAGCTGGGCNAAGTGGTTGGAGGAGATAGTAAGAAAGGAANGGTTGTCTTCCCTCNNGCNGCTATGGAAN
GGNNNGTGGTGGGGGGAAGTAAAGATGGNNNAAATGAGGAANGAANGGTTGGTTACACTCTGATCTCTGCCTTANCCCNG
GNTGCTTACANTGTAACCANGACCAAGTGACTTCCAACTTGTACCCGTATTGTNNTACTCNANAAANGANNGANAGGCCA
NGANAGGGGGAAGGAGNNNNNNAAGAATGGAAACNGANATGGGAANANGCNNTTTACCNNGCAAGACCTAAAGCACCNAC
TAAAANGANNNANGTGGCCATCATTCTTGGANCACATCTANGANNAAAAAGANTGTTTGTTTGTTTGTTNNNNGTNTTAA
NAGCTTTGGNNCCNNAATGATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13038A6HMF1
Sequence
AGAGGAGTATGAGCTGGGCTAAGTGGTTGGAGGAGATAGTAAGAAAGGAATGGTTGTCTTCCCTCAGGCTGCTATGGAAG
GGCAAGTGGTGGGGGGAAGTAAAGATGGCAGAAATGAGGAAGGAATGGTTGGTTACACTCTGATCTCTGCCTTANCCCTG
GCTGCTTACAGTGTAACCAGGACCAAGTGACTTCCAACTTGTACCCGTATTGTCATACTCGAGAAAGGAAGGAGAGGCCA
GGAGAGGGGGAAGGAGGGAGAGAAGAATGGAAACAGAGATGGGAAGAGGCAGTTTACCCAGCANNACCTAAAGCACCAAC
TAAAAGGAAACAAGTGGAACGCCATCAA
Sequence Type genomic DNA
Unitrap ID UNI30172

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34720641..34720977 331
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028295 (1810030N24Rik) NM_025471 RIKEN cDNA 1810030N24 gene Gene [Source:MGI Symbol;Acc:MGI:1913541]

 
Come back to gene ENSMUSG00000028295


For any suggestions or comments, please send an email to unitrap@crg.es