Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST441517
Clone ID OST441517
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST441517
Sequence
TTGCGTTTGAAGTCCATCCAGTGTCTACTGAGGTCCATGAAGGAGGAGTTGCTAGATTTTCATGCAAGATTTCATCAACC
GCCGCCTGCAGTCATAACATGGGAATTTAATAGAACAGCCCTGCCTACAACCATGGACA
Sequence Type mRNA
Unitrap ID UNI17261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72690509..72690645 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es