Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15111F1
Clone ID IST15111F1
Vector VICTR80
Project tigm

Sequence tag IST15111F1HMR1
Sequence
CTAATTTCTTAGCTCCAGCTAACCNGCACCAATTGTCACAGTAATTCCTCCTGCTCGTGACTCTAAAGCCAGAGCTCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22126484..22126563 78
NO GENE  


Sequence tag IST15111F1HMF2
Sequence
NCCTGATCAGCGTCAGAACGGCCCTGCCTAGAGCGATCTTTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180444378..180444421 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


Sequence tag IST15111F1BBF1
Sequence
NNNNGATCAGCGTCAGAACGGCCCTGCCTAGAGCGATCTTTGTGGCCNCGCTGGAGAGCGGACTGCGGAGACTGTTGTTC
CCTCGTTTCTGGGCACTAATAAAGGTGACTCCCTAGTGCTGGGGTTCTCAGGGACATGCACGAAGTTAATCCCTACTTCT
AAGGCAATCATCGAAGCAGAGCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180444236..180444418 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es