Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13435C1
Clone ID IST13435C1
Vector VICTR74
Project tigm

Sequence tag IST13435C1BBF1
Sequence
TTCTGTCTTCAGACACTCCAGAAAAGGGCGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI11071 UNI15524 UNI36344 UNI36345 UNI36346 UNI36347

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 136372807..136372842 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026455 (Klhl12) NM_153128 kelch-like 12 (Drosophila) Gene [Source:MGI (curated);Acc:Klhl12-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62264236..62264271 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 114467211..114467246 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 87131932..87131967 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034258 (Flvcr2) NM_145447 major facilitator superfamily domain containing 7C Gene [Source:MGI Symbol;Acc:MGI:2384974]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 48545475..48545510 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022311 (Csmd3) NP_001074860 CUB and Sushi multiple domains 3 Gene [Source:MGI Symbol;Acc:MGI:2386403]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16305840..16305875 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022792 (Yars2) NM_198246 tyrosyl-tRNA synthetase 2 (mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:1917370]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48074303..48074338 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 146675231..146675266 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078498 (OTTMUSG00000010670) predicted gene, OTTMUSG00000010670 Gene [Source:MGI Symbol;Acc:MGI:3651985]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33158422..33158457 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054280 (6030436E02Rik) NM_194340 RIKEN cDNA C330019G07 gene Gene [Source:MGI Symbol;Acc:MGI:2443658]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 125447539..125447574 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108168126..108168161 36
NO GENE  

 
Come back to gene ENSMUSG00000054280


For any suggestions or comments, please send an email to unitrap@crg.es