Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13114F9
Clone ID IST13114F9
Vector VICTR76
Project tigm

Sequence tag IST13114F9HMF2
Sequence
CCTGCCTGCCTGCCTGCCTGCNNGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13114F9BBF1
Sequence
CTGGGTCGTCGGGTGGGGACTTGAAAAGGCCGAAGGTGAGTGCAGTAGAGCAGAGGTCTCAAGACACCTGTCTTTGCAGA
ACACGGTCATGGGGTCACTCACTCATCTCTTCATTCACTCTGTCATCTGCAAGCATTTCCTGAGCCCAAAGATACACTCA
GCATTCAAGGATAAGAGAGACAAGTGACTTGCGAGGACCTCAGCTTCCAAAGTTAAAGTGTGTGTGTGTGTGTGTGTGTG
N
Sequence Type genomic DNA
Unitrap ID UNI29440

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110752728..110752967 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049719 (1700112C13Rik) NM_183103 RIKEN cDNA 1700112C13 gene Gene [Source:MGI Symbol;Acc:MGI:1921556]

 
Come back to gene ENSMUSG00000049719


For any suggestions or comments, please send an email to unitrap@crg.es