Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14141C9
Clone ID IST14141C9
Vector VICTR74
Project tigm

Sequence tag IST14141C9HMF1
Sequence
TTTTAATTACNNAAATCTTAAAATCNTNNNGTAAACAATANATTGANAAATGCCTGCCAATNTNAATANACAAATCAATG
TGTCATCAACAAATTTAAAGGAAAAATAGCTAAGCTGGAGAAATGACTGCCTGGCCTGCATGANGTCCCGGGTTATGCCC
AACATGGCATAAAACCAAGATGTGGTANCACACACCTGTTATCCCACCTCTAGTGAGATGCANGCAGGAACATCANAAGT
TNNNANTAAGTTACATGTCAGANTCNGCATGTAACATGGGACCCTGTGTAANAAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14141C9BBF1
Sequence
GTTTAATTACATAAATCTTAAAATCTTCAGGTAAACAATAGATTGAGAAATGCCTGCCAATTTTAATAGACAAATCAATG
TGTCATCAACAAATTTAAAGGAAAAATAGCTAAGCTGGAGAAATGACTGCCTGGCCTGCATGAGGTCCCGGGTTATGCCC
AACATGGCATAAAACCAAGATGTGGTAGCACACACCTGTTATCCCACCTCTAGTGAGATGCAGGCAGGAACATCAGAAGT
TCAGAGTAAGTTACATGTCANAGTCNGCATGTAACATGGGACCCTGTGTAANAAAAGAANGGGGGGGCTCANGGGTANAA
NGAGGGAGGGAAGGTGANAGAACNCNTACCNAAAATGTGACCNAACACCTTATAATCTCAGCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30899329..30899711 359
 
EST/CDNA Est Name
  BX521518.1


Sequence tag IST14141C9HMR1
Sequence
AACCTCCTTTTTATTTTTTCTGTGAGTGTGGTTCCTTGGTTTGTTGCCTTAGATAGATGAGTTTTCATTTACAAGTAGTC
TACAGTTCTGTACTGTGCAGAGTTTTAAGTAACCATCTTCTCAATATTATGTTTTGAGGTATAGTCATTAGTAGTTTTCT
GCTAATATTTTTAAAAAAGAGGTTTCTTATCACTACTTGTTTGAAATAACTTTTACACGCTGTATTTCTCATAGTGTANA
TAGATAATTGTCTATTCTGTGCCNTTGTTTGGGGAGAGAGCTTTTTGTTTTGGTTGAATATTGTGCATTTCACCAANAAT
TTCTTGCTTTTACNAGTGGGAACTTTTATTTCCTGTTATTTGTN
Sequence Type genomic DNA
Unitrap ID UNI9316

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30899709..30900071 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037643 (Prkci) NP_032883 protein kinase C, iota Gene [Source:MGI Symbol;Acc:MGI:99260]

 
Come back to gene ENSMUSG00000037643


For any suggestions or comments, please send an email to unitrap@crg.es