Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11583C8
Clone ID IST11583C8
Vector VICTR76
Project tigm

Sequence tag IST11583C8HMF1
Sequence
CCCCCGCCCCCAAAAAAGAAAAAAGAATAAAGACCCTTCGGAGAGTCTNTNTNCTCCACAGCTCACACCAAACCACAAAA
AAGATTGTCTATCAACAAAGCTTGGAAAAACTTACTTTTAATTTAACTTTATTTTTTACATACAANTTCCTAANATATTG
TTGANTTCTTCCTAACCTGTGGAGAGAATGTTTNAAGTCCCCTGTGGACGCCTAAAATAGTGAATANTGATGAACCTGGT
CTTTGCATGCACATCTNACATGTAGGCATGTAAGTATGCTCTCTGCTGTTTATTAAAATGCCTTTAATATTTCTGGACTG
AATGACTGTGGTAGTTGAAGTAGCGGAAGGTGAATCCTTGGGTAANAGGAGAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72592089..72592461 353
 
EST/CDNA Est Name
  BI788675.1 - AW319155.1 - CF580479.1 - BM195827.2 - CR757480.1 - BM021750.1 - CF580508.1 - BM197722.2 - BM021620.1 - BM195914.2


Sequence tag IST11583C8HMR1
Sequence
GGTAGTTTGGGTTTTTGGTTTTTGGAGACAGAGTTTCTCTGTGTAGCGCTGGCTGTCCTGAATCTCACCTCACTCTGTAG
ACCANTCTGTCCTGGAACTCANAAATCCGCCTGCCTCTGCTTCCCAAGTGCTGGGATTAAAGGCGTGCACCACCACTGCC
CAGCAGGGTTTTTATTCTTGTGGAAGATGGTGGGACCCCAGATAAGATCACACATAGCTCCCCCTCTACTTTATTTTATT
TTATTTTATTTTATTTTATGTTATGTTATGTGTAATGGTGTTTGTGCACCGTGTGCTTGCCTGTGGAGGCCAGAAGAGCA
TGTCAGATCCCCTAGTGCTACAGGGAGGTCGTGAGCCACCCAGTGTGGCTGCTAGGAGCCTAACTCCTGTCCCCTGCAAG
TGTGGGCTCTAAACAGCTGAGCTCTCTCCAGCCCTGGTACTGAAAGTCGTANCTGTGATCTGATCATGAAGGACAANTAT
AGAAATTATGCNTCTGAGAAACCCTCTGGCANCCATGCNTGCACATTTGGAAGTGATTATGGNATTTNANNANAANANTG
NNAAGAAAGTCTCANANCNNNTGTGANCTTGGTTATCTGGCGCTTGGGGTGTTGAGGATTGN
Sequence Type genomic DNA
Unitrap ID UNI15461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72592460..72593081 574
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es